Sequence ID | >W1710562340 |
Genome ID | FOOW01000034 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Prevotella sp. KH2C16 [FOOW] |
Start position on genome | 13748 |
End posion on genome | 13674 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctaacggcat |
tRNA gene sequence |
GCTGTAATAGCTCAGTGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCCTGAGTTCAACTC |
Downstream region at tRNA end position |
cttcttgttc |
Secondary structure (Cloverleaf model) | >W1710562340 Thr GGT t TCTA cttcttgttc G - C C - G T - A G - C T - A A - T A - T T C T G A C T C A G A A | | | | | A T C T C G C T G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |