Sequence ID | >W1710569909 |
Genome ID | FOUU01000009 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Thermodesulforhabdus norvegica [FOUU] |
Start position on genome | 76819 |
End posion on genome | 76744 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gcttttggtt |
tRNA gene sequence |
GGGCCGTTAACTCAGCAGGTAGAGTATCTGCCTTTTAAGCAGAGAGTCGCTGGTTCGAAT |
Downstream region at tRNA end position |
gtgaaatcaa |
Secondary structure (Cloverleaf model) | >W1710569909 Lys TTT t ACCA gtgaaatcaa G - C G - C G - C C - G C - G G - C T - A T A T C G A C C A C G A A | | | | | G A C T C A G C T G G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |