Sequence ID | >W1710575131 |
Genome ID | FOYX01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Maribacter stanieri [FOYX] |
Start position on genome | 1291439 |
End posion on genome | 1291519 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cggtaataat |
tRNA gene sequence |
GCTCGAGTGGCGGAACTGGTAGACGCGCTGGATTCAAAATCCAGTTCTTCGGAGTGCGGG |
Downstream region at tRNA end position |
aataaaaccc |
Secondary structure (Cloverleaf model) | >W1710575131 Leu CAA t ACag aataaaaccc G + T C - G T - A C - G G - C A - T G - C T T T C G C C C A C A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C T A G G TTCTTCGGAGT C - G T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |