Sequence ID | >W1710580078 |
Genome ID | FPJA01000010 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Selenomonas ruminantium [FPJA] |
Start position on genome | 165470 |
End posion on genome | 165395 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ccaatatcat |
tRNA gene sequence |
GACTCACTAGCTCAACTGGCAGAGCAACTGACTCTTAATCAGTAGGTTCACGGTTCGATT |
Downstream region at tRNA end position |
ttatatgggc |
Secondary structure (Cloverleaf model) | >W1710580078 Lys CTT t ACCA ttatatgggc G - C A - T C - G T + G C - G A - T C - G T T T G T G C C A C A A A | | | | | G T C T C G C A C G G C G | | | | T T G G A G C C A A AGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |