Sequence ID | >W1710587370 |
Genome ID | FQYL01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces denticolens [FQYL] |
Start position on genome | 174553 |
End posion on genome | 174477 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ggcgtcgcgc |
tRNA gene sequence |
GCCTCCGTAGCCCAACTGGCAGAGGCATCCGACTCAAAATCGGAGTGTTGTGGGTTCGAG |
Downstream region at tRNA end position |
ctgaggagcg |
Secondary structure (Cloverleaf model) | >W1710587370 Leu CAA c ACCG ctgaggagcg G + T C - G C - G T - A C - G C - G G - C T G T C A C C C A C A A A | | | | | G T C C C G G T G G G C G | | | T T G A G G C C A G A GTGTT T - A C - G C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |