Sequence ID | >W1710588603 |
Genome ID | FQZM01000084 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Desulfofundulus thermosubterraneus DSM 16057 [FQZM] |
Start position on genome | 164 |
End posion on genome | 241 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
taggtaatgt |
tRNA gene sequence |
CGGGGCGTAGCTCAGTTTGGCTAGAGCGCTACCTTGGGGTGGTAGAGGTCGCACGTTCGA |
Downstream region at tRNA end position |
aagaaaagcc |
Secondary structure (Cloverleaf model) | >W1710588603 Pro GGG t ACCA aagaaaagcc C - G G - C G - C G + T G - C C - G G - C T G T T G T G C A T T G A A + | | | | G T C T C G G C A C G C G | | | | T T G G A G C C T A G AGGTC C - G T - A A - T C - G C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |