Sequence ID | >W1710588951 |
Genome ID | FQZT01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Malonomonas rubra DSM 5091 [FQZT] |
Start position on genome | 68753 |
End posion on genome | 68677 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gctgatttga |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACGTGCATGGGGTGCACGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
tcagcgttta |
Secondary structure (Cloverleaf model) | >W1710588951 Pro GGG a ACCA tcagcgttta C - G G - C G - C G - C G - C C - G G - C T A T T C T C C A C G A A + | | | | A C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G G - C T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |