Sequence ID | >W1710589902 |
Genome ID | FRAO01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium johnsoniae [FRAO] |
Start position on genome | 1565842 |
End posion on genome | 1565915 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttttttaatt |
tRNA gene sequence |
ACGGGCGTAGTTCAAGGGTAGAATAGCGGTCTCCAAAACCGTTGATGGGGGTTCGAATCC |
Downstream region at tRNA end position |
taaaaaatat |
Secondary structure (Cloverleaf model) | >W1710589902 Trp CCA t GCAA taaaaaatat A - T C - G G - C G - C G - C C - G G - C T A T C T C C C A A A A | + | | | G G C T T G G G G G G C G | | | + T T G G A A T T A A TGAT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |