Sequence ID | >W1710592613 |
Genome ID | FRCP01000010 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Anaerosporobacter mobilis DSM 15930 [FRCP] |
Start position on genome | 274876 |
End posion on genome | 274964 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agcaacacaT |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTTAAGGAGCTGGTCTTGAAAACCAGTGACTCCGAAAGGGGC |
Downstream region at tRNA end position |
cgatgtaaga |
Secondary structure (Cloverleaf model) | >W1710592613 Ser TGA T GTCg cgatgtaaga G - C G - C A - T G - C A - T G + T G - C T A T C A C C C A T G A G | | | | | G G G C C T G T G G G C G | | | T T T A G G A T T A G TGACTCCGAAAGGGGCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |