Sequence ID | >W1710593915 |
Genome ID | FSQW01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Parasphingorhabdus marina DSM 22363 [FSQW] |
Start position on genome | 1579109 |
End posion on genome | 1579036 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccccctctcc |
tRNA gene sequence |
GGCCCGATGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ggagactttc |
Secondary structure (Cloverleaf model) | >W1710593915 Cys GCA c TCCA ggagactttc G - C G - C C - G C - G C - G G - C A - T T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |