Sequence ID | >W1710593963 |
Genome ID | FSQX01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas meridiana [FSQX] |
Start position on genome | 3583872 |
End posion on genome | 3583796 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cagcaacttt |
tRNA gene sequence |
CGGAATATAGCTCAGCTTGGTAGAGCGCTGCCTTCGGGAGGCAGAGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
agaattcaat |
Secondary structure (Cloverleaf model) | >W1710593963 Pro CGG t ACCA agaattcaat C - G G - C G - C A - T A - T T - A A - T T A T C G T C C A C G A A | + | | | G T C T C G G T A G G C T | | | | T T G G A G C G T A G AGGTC C - G T - A G - C C - G C - G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |