Sequence ID | >W1710594128 |
Genome ID | FSRA01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chitinophaga niabensis [FSRA] |
Start position on genome | 1219628 |
End posion on genome | 1219702 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aatgggaaat |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCGTTGGTTCAAG |
Downstream region at tRNA end position |
aaagtataaa |
Secondary structure (Cloverleaf model) | >W1710594128 Asn GTT t GCag aaagtataaa T - A C - G C - G T + G C - G C - G T - A T G T C A A C C A T G A A | | | | | A T C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |