Sequence ID | >W1710594472 |
Genome ID | FSRG01000004 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Halodesulfovibrio marinisediminis DSM 17456 [FSRG] |
Start position on genome | 102148 |
End posion on genome | 102073 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttcctcgaga |
tRNA gene sequence |
GGGTCGTTAACTCAGTTGGTAGAGTATCTGCCTTTTAAGCAGAGAGTCACTGGTTCGAGC |
Downstream region at tRNA end position |
ctgaactcac |
Secondary structure (Cloverleaf model) | >W1710594472 Lys TTT a ACCA ctgaactcac G - C G - C G - C T - A C - G G - C T - A C G T T G A C C A T G A A | | | | | G T C T C A A C T G G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |