Sequence ID | >W1710594511 |
Genome ID | FSRG01000009 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Halodesulfovibrio marinisediminis DSM 17456 [FSRG] |
Start position on genome | 60935 |
End posion on genome | 60850 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aacataatca |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGCCAAAGGGAACAGACTGTAAATCTGTCGGCGTATGCCTTCGG |
Downstream region at tRNA end position |
cgaaaattta |
Secondary structure (Cloverleaf model) | >W1710594511 Tyr GTA a ACCA cgaaaattta G - C G - C T - A G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | A G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCGTATGCCTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |