Sequence ID | >W1710595602 |
Genome ID | FTMA01000007 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Maribacter ulvicola [FTMA] |
Start position on genome | 62469 |
End posion on genome | 62545 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cttacaaatg |
tRNA gene sequence |
GTGGTTGTAGCTCAGCTGGTTAGAGCATCGGTTTGTGGTACCGAGGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
aagcaagtaa |
Secondary structure (Cloverleaf model) | >W1710595602 His GTG g CCTA aagcaagtaa G - C T - A G - C G - C T T T T G - C C A T T G G C C A C G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G G - C G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |