Sequence ID | >W1710598190 |
Genome ID | FTNU01000034 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Moraxella cuniculi DSM 21768 [FTNU] |
Start position on genome | 3479 |
End posion on genome | 3404 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caccatttat |
tRNA gene sequence |
GGGGTTATAGCTCAGTTGGTAGAGCGCCTGCCTTGCACGCAGGAGGTCAGGAGTTCGACT |
Downstream region at tRNA end position |
ttaattagaa |
Secondary structure (Cloverleaf model) | >W1710598190 Ala TGC t ACCA ttaattagaa G - C G - C G + T G - C T - A T - A A - T T C T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C T A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |