Sequence ID | >W1710598486 |
Genome ID | FTOA01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Insolitispirillum peregrinum [FTOA] |
Start position on genome | 617670 |
End posion on genome | 617756 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgaaccacct |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCAGGTTTCAGGTACCTGTGGCAGAAATGTCGTG |
Downstream region at tRNA end position |
tcggcttggt |
Secondary structure (Cloverleaf model) | >W1710598486 Leu CAG t ACCA tcggcttggt G - C C - G C - G C - G A - T G - C G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGCAGAAATGTCGT C - G A - T G - C G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |