Sequence ID | >W1710600135 |
Genome ID | FTPS01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Pontibaca methylaminivorans [FTPS] |
Start position on genome | 1143988 |
End posion on genome | 1144071 |
Amino Acid | Pseudo |
Anticodon | GTA |
Upstream region at tRNA start position |
cgcaagatat |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAAATCCCTCGCGGAGACGCACGCCTG |
Downstream region at tRNA end position |
tttcttccga |
Secondary structure (Cloverleaf model) | >W1710600135 Pseudo GTA t ACCA tttcttccga G - C G - C G - C C - G G - C A - T C - G T T A G G A C C A A C G | | | | | G A G C C G C C T G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |