Sequence ID | >W1710602171 |
Genome ID | FUYA01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobaculum bizertense DSM 18034 [FUYA] |
Start position on genome | 580096 |
End posion on genome | 580001 |
Amino Acid | SeC(p) |
Anticodon | TCA |
Upstream region at tRNA start position |
ttttccgctc |
tRNA gene sequence |
GGAGGGTCTTCCAGTCTGGTGGCTGGCGCGGTCTTCAAAACCGTCTGAATCGTTGGAGAA |
Downstream region at tRNA end position |
atactcctgt |
Secondary structure (Cloverleaf model) | >W1710602171 SeC(p) TCA c GCCA atactcctgt G - C G - C A - T G - C G - C G - C T - A C - G T T T T G T C C A T C T T + | | | | G G G A C C G C A G G C G | | | | T T T C T G G G G C CTGAATCGTTGGAGAAACGATTG G + T C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |