Sequence ID | >W1710602299 |
Genome ID | FUYC01000003 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Paucidesulfovibrio gracilis DSM 16080 [FUYC] |
Start position on genome | 143375 |
End posion on genome | 143299 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
taaaaatgtg |
tRNA gene sequence |
GTGGCTGTGGCGCAGTTGGTTAGCGCGTTAGGTTGTGGCCCTGAAGGCCGAGGGTTCAAA |
Downstream region at tRNA end position |
ctgaattcaa |
Secondary structure (Cloverleaf model) | >W1710602299 His GTG g CCCA ctgaattcaa G - C T - A G - C G - C C - G T - A G - C T A T C T C C C A T G A G | | | | | A T C G C G G A G G G C G | | | | T T G G C G C T T A G AGGCC T - A T + G A - T G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |