Sequence ID | >W1710602357 |
Genome ID | FUYD01000006 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium sp. USBA 49 [FUYD] |
Start position on genome | 12893 |
End posion on genome | 12819 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccaccatttt |
tRNA gene sequence |
GCGGGAGTGACTCAATGGTAGAGTGTCACCTTGCCAAGGTGAAAGTTGCGGGTTCGAATC |
Downstream region at tRNA end position |
gtatggcgct |
Secondary structure (Cloverleaf model) | >W1710602357 Gly GCC t TCCA gtatggcgct G - C C - G G - C G - C G + T A - T G - C T A T T G C C C A A A G + | | | | G T C T C A G C G G G C G | | | | T T G G A G T T A G AAGTT T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |