Sequence ID | >W1710606570 |
Genome ID | FWXX01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tropicibacter naphthalenivorans [FWXX] |
Start position on genome | 586 |
End posion on genome | 497 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
agacccccgc |
tRNA gene sequence |
GGAGAGGTGCCGGAGTGGTCGAACGGGGCGGTCTCGAAAACCGTTGTCCCTTCACGGGGA |
Downstream region at tRNA end position |
cccccctaag |
Secondary structure (Cloverleaf model) | >W1710606570 Ser CGA c GCCA cccccctaag G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A T G A G | | | | | G G G G C C C A G G G C G | | | T T T A C G G C G A G TGTCCCTTCACGGGGACC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |