Sequence ID | >W1710606611 |
Genome ID | FWXY01000003 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfocicer vacuolatum DSM 3385 [FWXY] |
Start position on genome | 261914 |
End posion on genome | 261839 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cacatcgtta |
tRNA gene sequence |
GCGGGCATAGCTCAGTTGGTAGAGTACAAGCTTCCCAAGCTTGGTGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
gattataaat |
Secondary structure (Cloverleaf model) | >W1710606611 Gly CCC a TCCA gattataaat G - C C - G G - C G - C G - C C - G A - T T A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | + T T G G A G T T A A GTGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |