| Sequence ID | >W1710609703 |
| Genome ID | FXXD01000002 |
| Phylum/Class | Bacillota |
| Species | Caldicellulosiruptor bescii [FXXD] |
| Start position on genome | 1019682 |
| End posion on genome | 1019766 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
gcaaaaacaa |
| tRNA gene sequence |
GCGGGTATGGCGGAATTGGCAGACGCGCTAGACTTAGGATCTAGTGGCAACAGCCGTGGG |
| Downstream region at tRNA end position |
agagaaaaat |
| Secondary structure (Cloverleaf model) | >W1710609703 Leu TAG
a ACCA agagaaaaat
G - C
C - G
G - C
G - C
G - C
T - A
A - T T G
T C T C C C A
T A A G | + | | | A
T G G C G G G G G G C
G | | | T T
G A C G C
C A G G TGGCAACAGCCGT
C - G
T - A
A - T
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |