Sequence ID | >W1710615013 |
Genome ID | JDUH01000009 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium boum DSM 20432 [JDUH] |
Start position on genome | 45358 |
End posion on genome | 45285 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acgccgccga |
tRNA gene sequence |
TCCCCCATGGTGTAATGGCAGCACACGGGTCTTTGGAACCCTTTGTCTTGGTTCGAGTCC |
Downstream region at tRNA end position |
gaagcggttc |
Secondary structure (Cloverleaf model) | >W1710615013 Gln TTG a ACCC gaagcggttc T - A C - G C - G C - G C - G C - G A - T T G T G G A C C A A A G | + | | | G T T G T G C T T G G C G + | | | T T G G C A C C A A TTGT C T G - C G - C G - C T - A C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |