Sequence ID | >W1710615143 |
Genome ID | JDUK01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 [JDUK] |
Start position on genome | 330544 |
End posion on genome | 330631 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgatgcacat |
tRNA gene sequence |
GGGTAGGTGTCTGAGCGGTCTAAAGAGACGGTCTTGAAAACCGTTGAGGTGCAAGCCTCC |
Downstream region at tRNA end position |
atcaggctta |
Secondary structure (Cloverleaf model) | >W1710615143 Ser TGA t GCCT atcaggctta G - C G - C G - C T - A A - T G + T G - C T A T C G C T C A C G A G | | | | | G G G T C T G C G A G C G | | | T T T A A G A C T A G TGAGGTGCAAGCCTCC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |