Sequence ID | >W1710615644 |
Genome ID | JDUW01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium reuteri DSM 23975 [JDUW] |
Start position on genome | 485 |
End posion on genome | 410 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gcgcaatttt |
tRNA gene sequence |
GGGGCTATAGCGCAGCTGGTAGCGCATCTCCATGGCATGGAGAGGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
agaggttgct |
Secondary structure (Cloverleaf model) | >W1710615644 Ala GGC t ACGA agaggttgct G - C G - C G + T G - C C - G T - A A - T T A T C C C C C A C G A A | | | | | G T C G C G G G G G G C G | | | | T T G G C G C T A A GGGTC T - A C - G T - A C - G C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |