Sequence ID | >W1710617233 |
Genome ID | JGVX01000003 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi [JGVX] |
Start position on genome | 437505 |
End posion on genome | 437591 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tgccatactg |
tRNA gene sequence |
GCCGAGATGGTGGAATGGCAGACACGCTAGCTTGAGGGGCTAGTGAGTGATGAGCTCGTG |
Downstream region at tRNA end position |
ataagttata |
Secondary structure (Cloverleaf model) | >W1710617233 Leu GAG g ACCA ataagttata G - C C - G C - G G - C A - T G - C A - T T A T C C C T C A T A A G | | | | | A G G G T G G G G A G C G | | | T T C A C A C A G G TGAGTGATGAGCTCGT C - G T - A A - T G - C C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |