Sequence ID | >W1710621369 |
Genome ID | JNDE01000120 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Cronobacter sakazakii [JNDE] |
Start position on genome | 83572 |
End posion on genome | 83659 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atgacaatat |
tRNA gene sequence |
GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATC |
Downstream region at tRNA end position |
tattcaaaga |
Secondary structure (Cloverleaf model) | >W1710621369 Ser GGA t GCCA tattcaaaga G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T G A G TATACGGCAACGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |