Sequence ID | >W1710628375 |
Genome ID | JPUA01000048 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas campaniensis [JPUA] |
Start position on genome | 691 |
End posion on genome | 767 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gcttttaagt |
tRNA gene sequence |
GGACCGGTAGTTCAGTCGGTTAGAATGCCGGCCTGTCACGCCGGAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
ttaagcattt |
Secondary structure (Cloverleaf model) | >W1710628375 Asp GTC t GCCA ttaagcattt G - C G - C A - T C - G C - G G - C G - C T G T T G C T C A T G A A + | | | | G C C T T G G C G A G C G | | | + T T G G A A T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |