Sequence ID | >W1710628599 |
Genome ID | JPVZ01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Thalassospira tepidiphila MCCC 1A03514 [JPVZ] |
Start position on genome | 356507 |
End posion on genome | 356431 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cacgcaccat |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGCGCCGGCCTGTCACGCCGGAGGCCGCGAGTTCAAG |
Downstream region at tRNA end position |
ttcccttcct |
Secondary structure (Cloverleaf model) | >W1710628599 Asp GTC t GCCA ttcccttcct G - C C - G G - C G + T G - C T - A G - C T G T T G C T C A T G A A + | | | | A T C T C G G C G A G C G | | | | T T G G A G C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |