Sequence ID | >W1710628656 |
Genome ID | JPWE01000012 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Thalassospira profundimaris [JPWE] |
Start position on genome | 3971 |
End posion on genome | 4047 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aaacccatag |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCGTTCGCTTGACATGCGAGAGGTCACAAGTTCGAG |
Downstream region at tRNA end position |
ttcccacccc |
Secondary structure (Cloverleaf model) | >W1710628656 Val GAC g ACCA ttcccacccc G - C G - C G - C C - G C - G T - A A - T T G T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T T A G AGGTC T + G T - A C - G G - C C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |