Sequence ID | >W1710646704 |
Genome ID | JTHW01000024 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus rhamnosus [JTHW] |
Start position on genome | 871 |
End posion on genome | 944 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tccgctttac |
tRNA gene sequence |
CGGGAAGTAGCTCAGCTTGGTAGAGCACTACGTTCGGGACGTAGGGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
ttggatcacg |
Secondary structure (Cloverleaf model) | >W1710646704 Pro CGG c Attc ttggatcacg C - G G - C G - C G - C A - T A - T G - C T A T T G T T C A C G A A + | | | | G T C T C G G C A A G C T | | | | T T G G A G C G T A A GGGTC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |