Sequence ID | >W1710647234 |
Genome ID | JTIH01000002 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus rhamnosus [JTIH] |
Start position on genome | 17580 |
End posion on genome | 17494 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tattgttgtT |
tRNA gene sequence |
GCCGCGATGGCGGAACTGGCAGACGCGCAGTGTTCAGGTCGCTGTGGGATTTATTCCCGT |
Downstream region at tRNA end position |
cataggatat |
Secondary structure (Cloverleaf model) | >W1710647234 Leu CAG T ATtt cataggatat G - C C - G C - G G - C C - G G - C A - T T T T T G T C C A C A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C C A G G TGGGATTTATTCCCGT C - G A - T G - C T + G G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |