Sequence ID | >W1710648314 |
Genome ID | JTJO01000034 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Gallibacterium anatis [JTJO] |
Start position on genome | 140702 |
End posion on genome | 140626 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cttacccact |
tRNA gene sequence |
GCCCCCATAGCTCAGTCGGTCAGAGCAGTCGACTCATAATCGATTGGTCACAGGTTCAAG |
Downstream region at tRNA end position |
ataaaaagtt |
Secondary structure (Cloverleaf model) | >W1710648314 Met CAT t ACCA ataaaaagtt G - C C - G C - G C - G C - G C - G A - T T G T T G T C C A T G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C T C A A TGGTC G + T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |