Sequence ID | >W1710648594 |
Genome ID | JTJU01000013 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Gallibacterium salpingitidis [JTJU] |
Start position on genome | 3512 |
End posion on genome | 3436 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tctttccgat |
tRNA gene sequence |
GCCCCCATAGCTCAGTCGGTCAGAGCAGTCGACTCATAATCGATTGGTCACAGGTTCAAG |
Downstream region at tRNA end position |
ataaacagtt |
Secondary structure (Cloverleaf model) | >W1710648594 Met CAT t ACCA ataaacagtt G - C C - G C - G C - G C - G C - G A - T T G T T G T C C A T G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C T C A A TGGTC G + T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |