Sequence ID | >W1710657111 |
Genome ID | JXGU01000361 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas oryzae pv. oryzae [JXGU] |
Start position on genome | 7611 |
End posion on genome | 7684 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ccagtgccac |
tRNA gene sequence |
GCGGGCGTAGCTCAATGGTAGAGCTGTAGCTTCCCAAGCTACTGACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tgtcctgcaa |
Secondary structure (Cloverleaf model) | >W1710657111 Gly CCC c TCCA tgtcctgcaa G - C C - G G - C G - C G - C C - G G - C T T T T A C C C A A A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A T TGAC G - C T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |