Sequence ID | >W1710660388 |
Genome ID | JXQD01000016 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio sp. qd031 [JXQD] |
Start position on genome | 384 |
End posion on genome | 308 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gcaatggttt |
tRNA gene sequence |
GGGTCTGTAGCTCAGCTGGTTAGAGCGCTCGCCTGATAAGCGGGAGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
aatctttccg |
Secondary structure (Cloverleaf model) | >W1710660388 Ile GAT t ACCA aatctttccg G - C G - C G - C T - A C - G T - A G - C T G T T C A C C A C G A A + | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G T + G C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |