Sequence ID | >W1710694309 |
Genome ID | LAIH01000005 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Citromicrobium sp. JL31 [LAIH] |
Start position on genome | 71584 |
End posion on genome | 71673 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ttcccagtgc |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTTAAGGCAGCGGTCTTGAAAACCGCCGTGGGTTTACGCTCA |
Downstream region at tRNA end position |
tttccccctc |
Secondary structure (Cloverleaf model) | >W1710694309 Ser TGA c GCCA tttccccctc G - C G - C A - T C - G A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGGTTTACGCTCACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |