Sequence ID | >W1710694353 |
Genome ID | LAIJ01000009 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Terracidiphilus gabretensis [LAIJ] |
Start position on genome | 827066 |
End posion on genome | 827142 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttgatagagc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGAATGCCTCCGGAGCATTAGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tcccttctac |
Secondary structure (Cloverleaf model) | >W1710694353 Arg CCG c ACCA tcccttctac G - C C - G G - C C - G C - G C - G G - C T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C A T A G AGGTC A - T A - T T - A G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |