Sequence ID | >W1710694572 |
Genome ID | LAPS01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Citromicrobium sp. WPS32 [LAPS] |
Start position on genome | 302809 |
End posion on genome | 302733 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggggcatatg |
tRNA gene sequence |
GCGATCGTAGCTCAGTTGGTTAGAGCGCCGGTTTGTGGTACCGGAGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ttttcccctg |
Secondary structure (Cloverleaf model) | >W1710694572 His GTG g CCCA ttttcccctg G - C C - G G - C A - T T - A C - G G - C A G T T C C C C A T G A A + | | | | G T C T C G G G G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |