Sequence ID | >W1710703059 |
Genome ID | LBHK01000069 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella feeleii [LBHK] |
Start position on genome | 679 |
End posion on genome | 591 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acaaaaatat |
tRNA gene sequence |
GCCCAGGTGGCGAAACAGGTAGACGCAAGGGACTTAAAATCCCTCGGAGGTTAAACTCCG |
Downstream region at tRNA end position |
attacacatt |
Secondary structure (Cloverleaf model) | >W1710703059 Leu TAA t ACCA attacacatt G - C C - G C - G C - G A - T G - C G - C T C T C G G C C A C A A G | | | | | G A A G C G G C C G G C G | | | T T G A C G C T A G A CGGAGGTTAAACTCCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |