Sequence ID | >W1710705579 |
Genome ID | LDIV01000001 |
Search identical group | |
Phylum/Class | Unclassified |
Species | candidate division TM6 bacterium UASB124 [LDIV] |
Start position on genome | 442367 |
End posion on genome | 442292 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gtatagaggc |
tRNA gene sequence |
GCCCACGTAGCTCAGTTGGTAGAGCACTTCCTTGGTAAGGGAGAGGTCACCGGTTCAATC |
Downstream region at tRNA end position |
cttaatagtt |
Secondary structure (Cloverleaf model) | >W1710705579 Thr GGT c TCCA cttaatagtt G - C C - G C - G C - G A C C - G G - C C T T T G G C C A T G A A | | | | | A T C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T + G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |