Sequence ID | >W1710719251 |
Genome ID | LFGT01000026 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. BC2 [LFGT] |
Start position on genome | 135119 |
End posion on genome | 135195 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gttgcacagc |
tRNA gene sequence |
AGGACCATAGCTCAGTTGGTTAGAGCGCCACGTTGACATCGTGGAGGTCGGCGGTTCAAA |
Downstream region at tRNA end position |
atcatgtgca |
Secondary structure (Cloverleaf model) | >W1710719251 Val GAC c ACCA atcatgtgca A - T G - C G - C A - T C - G C - G A - T T A T C C G C C A T G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |