Sequence ID | >W1710723511 |
Genome ID | LFOY01000004 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium botulinum [LFOY] |
Start position on genome | 227 |
End posion on genome | 151 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tccataatat |
tRNA gene sequence |
GCGTCTTTAGCTCAGATGGATAGAGCAACGCCCTTCTAAGGCGTGGGCCAGGGGTTCGAA |
Downstream region at tRNA end position |
aataagtgcc |
Secondary structure (Cloverleaf model) | >W1710723511 Arg TCT t ACCA aataagtgcc G - C C - G G - C T - A C - G T - A T - A T A T T T C C C A A G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |