Sequence ID | >W1710730430 |
Genome ID | LFVX01000007 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingobium sp. Ndbn-10 [LFVX] |
Start position on genome | 80027 |
End posion on genome | 80103 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agcccctgtg |
tRNA gene sequence |
GCGATCGTAGCTCAGTTGGTTAGAGCGCCGGTTTGTGGTACCGGAGGTCGCGGGTTCGGA |
Downstream region at tRNA end position |
ttttccttct |
Secondary structure (Cloverleaf model) | >W1710730430 His GTG g CCCA ttttccttct G - C C - G G - C A - T T - A C - G G - C T A T T G C C C G T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |