Sequence ID | >W1710734326 |
Genome ID | LGFL01000022 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacterales bacterium 50_218 [LGFL] |
Start position on genome | 1260 |
End posion on genome | 1335 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gcaaccagat |
tRNA gene sequence |
GCCCACATAGCTCAGTAGGCAGAGCGTCGCCTTGGTAAGGCGGAGGTCACCGGTTCGATC |
Downstream region at tRNA end position |
tctgaaccca |
Secondary structure (Cloverleaf model) | >W1710734326 Thr GGT t TCCA tctgaaccca G - C C - G C - G C - G A - T C - G A - T C T T T G G C C A T G A A | | | | | G A C T C G A C C G G C G | | | | T T G G A G C C A G AGGTC T + G C - G G - C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |