Sequence ID | >W1710736074 |
Genome ID | LGJH01000156 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Novosphingobium sp. ST904 [LGJH] |
Start position on genome | 69521 |
End posion on genome | 69447 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gaacgtcaga |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCACAACCTTGCCAAGGTTGGGGTCGAGGGTTCGAATC |
Downstream region at tRNA end position |
gtttccttcg |
Secondary structure (Cloverleaf model) | >W1710736074 Gly GCC a TCCA gtttccttcg G - C C - G G - C G - C G - C C - G G - C T A T T T C C C A G A A + | | | | G G C T C G G A G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |