Sequence ID | >W1710743872 |
Genome ID | LGYU01000035 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Chitinophagaceae bacterium PMP191F [LGYU] |
Start position on genome | 550 |
End posion on genome | 474 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caaaatgcga |
tRNA gene sequence |
GGATCGGTAGTTCAGTTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
attttctcag |
Secondary structure (Cloverleaf model) | >W1710743872 Asp GTC a GCAA attttctcag G - C G - C A - T T + G C - G G - C G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |