Sequence ID | >W1710748284 |
Genome ID | LHOZ01000019 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Frigoribacterium sp. RIT-PI-h [LHOZ] |
Start position on genome | 18358 |
End posion on genome | 18282 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cagcaagttt |
tRNA gene sequence |
GGCCCTGTAGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCCGGTTCAAG |
Downstream region at tRNA end position |
aggcgagttc |
Secondary structure (Cloverleaf model) | >W1710748284 Asp GTC t GCCA aggcgagttc G - C G + T C - G C - G C - G T - A G - C T G T T G G C C A T G A A + | | | | A T C G C G G C C G G C G | | | | T T G G C G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |